Identificación de antibióticos basándose en diferencias estructurales en el alosterio conservado del hemo mitocondrial
HogarHogar > Blog > Identificación de antibióticos basándose en diferencias estructurales en el alosterio conservado del hemo mitocondrial

Identificación de antibióticos basándose en diferencias estructurales en el alosterio conservado del hemo mitocondrial

Aug 16, 2023

Nature Communications volumen 13, número de artículo: 7591 (2022) Citar este artículo

3938 Accesos

46 altmétrico

Detalles de métricas

Se publicó una corrección del autor de este artículo el 21 de diciembre de 2022.

Este artículo ha sido actualizado

La resistencia a los antimicrobianos (RAM) es un problema de salud mundial. A pesar de los enormes esfuerzos realizados en la última década, las amenazas de algunas especies, incluida la Neisseria gonorrhoeae resistente a los medicamentos, siguen aumentando y serían intratables. Se necesita seriamente el desarrollo de antibióticos con un mecanismo de acción diferente. Aquí, identificamos un sitio inhibidor alostérico enterrado dentro de las hemo-oxidasas de cobre (HCO) mitocondriales eucariotas, las enzimas respiratorias esenciales para la vida. La conformación estérica alrededor de la bolsa de unión de los HCO está muy conservada entre bacterias y eucariotas, aunque estos últimos tienen una hélice adicional. Esta diferencia estructural en el alosterio conservado nos permitió identificar racionalmente inhibidores bacterianos específicos de HCO: un compuesto antibiótico contra Neisseria gonorrhoeae resistente a la ceftriaxona. La dinámica molecular combinada con espectroscopia de resonancia Raman y espectroscopia de flujo detenido reveló una obstrucción alostérica en el canal de acceso al sustrato como mecanismo de inhibición. Nuestro enfoque abre nuevas vías en la modulación de las funciones de las proteínas y amplía nuestras opciones para superar la resistencia a los antimicrobianos.

La resistencia a los antimicrobianos (RAM) es un problema de salud mundial1. Se han realizado muchos esfuerzos para reducir la carga de los peligros de la RAM a nivel mundial desde 2013, pero las amenazas de algunas especies siguen aumentando de todos modos: Neisseria gonorrhoeae resistente a los medicamentos es una de las cinco amenazas urgentes2,3. Se ha informado y continúa surgiendo a nivel mundial4. La infección gonocócica podría volverse intratable debido al alto grado de RAM, lo que aumentaría las complicaciones graves: infertilidad, embarazo ectópico y aumento de la transmisión del VIH. La aparición de patógenos resistentes a los antibióticos actualmente disponibles es muy alarmante; por lo tanto, el desarrollo de opciones de tratamiento es imperativo para abordar la resistencia a los antimicrobianos.

La cadena respiratoria ha atraído recientemente una considerable atención científica como objetivo potencial de los antibióticos. Como arma para superar la resistencia a los antimicrobianos, se han aprobado o han entrado en ensayos clínicos compuestos dirigidos a la cadena respiratoria, por ejemplo, medicamentos contra parásitos, hongos y, especialmente, Mycobacterium tuberculosis resistente a los medicamentos5,6,7,8,9,10. Sin embargo, la mayoría de ellos son inhibidores competitivos de los sitios ortostéricos. Como las enzimas respiratorias son esenciales para la vida, su estructura central generalmente se conserva en todas las especies. La similitud estructural y la similitud de sustratos con las proteínas del huésped suponen riesgos de reactividad cruzada, lo que podría ser una causa de efectos secundarios11. Por lo tanto, un inhibidor alostérico es una opción más factible ya que los sitios alostéricos están evolutivamente menos conservados en la secuencia de aminoácidos que los sitios ortostéricos, lo que teóricamente mejora la selectividad y reduce la toxicidad12,13. Sin embargo, aún no se ha establecido una búsqueda sistemática y estratégica de inhibidores alostéricos, especialmente contra proteínas de membrana; la mayoría de las enzimas respiratorias son proteínas de membrana.

Los HCO son enzimas respiratorias terminales presentes en los tres dominios de la vida: bacterias, arqueas y eucariotas. Los HCO reciben electrones de la cadena respiratoria y reducen el oxígeno molecular a agua. Esta reacción exergónica se combina con el bombeo de protones a través de la membrana, lo que contribuye a mantener la fuerza motriz de los protones que se utiliza aún más para la producción de ATP14,15,16,17,18. Los HCO son complejos de múltiples subunidades y su constitución varía entre especies; sin embargo, la subunidad I es una subunidad catalítica común en todos los HCO. Contiene un hemo de bajo espín y un centro binuclear (BNC), el sitio catalítico formado por un hemo de alto espín y un ion cobre. El hemo de bajo espín recibe primero electrones y los transfiere al BNC para la reducción del oxígeno16,17,18,19.

Los eucariotas se originan a partir de la simbiosis entre Alphaproteobacteria y Archaea20. Por lo tanto, las subunidades I a III codificadas por el ADN mitocondrial de la citocromo c oxidasa mitocondrial (mtCcO), análogas a los HCO eucarióticos, son descendientes de las enzimas respiratorias de las bacterias20,21 y residuos funcionalmente importantes y, por tanto, su estructura central se conserva, aunque la Los residuos restantes no son los mismos. Además, el mtCcO de los mamíferos tiene 10 subunidades más codificadas por el ADN genómico. Las funciones fisiológicas de estas subunidades no están completamente aclaradas16. Las estructuras centrales de proteínas fundamentales como las ARN polimerasas o los ribosomas también son similares entre especies; Curiosamente, han adquirido subunidades adicionales que modulan su función a lo largo de la evolución molecular22,23. Por lo tanto, planteamos la hipótesis de que la superficie de la estructura central de los HCO, que están cubiertas por hélices adicionales en los mamíferos, podría contener sitios alostéricos, que regulan su actividad positiva o negativamente. La existencia de una hélice adicional en el mtCcO de los mamíferos diferencia las bolsas de los HCO bacterianos.

En este trabajo, identificamos un sitio inhibidor alostérico enterrado dentro del mtCcO eucariota. La conformación estérica alrededor de la bolsa de unión de los HCO está muy conservada entre bacterias y eucariotas, aunque estos últimos tienen una hélice adicional. La diferencia estructural en el alosterio conservado nos permite identificar racionalmente inhibidores bacterianos específicos de HCO: un compuesto antibiótico contra Neisseria gonorrhoeae resistente a la ceftriaxona.

Para probar esta hipótesis, primero necesitamos identificar un sitio inhibidor alostérico. Comenzamos con inhibidores de mtCcO de mamíferos obtenidos mediante detección de compuestos aleatorios. Anteriormente hemos descubierto que una proteína endógena interactúa directamente con mtCcO y modula alostéricamente la actividad de mtCcO24,25. Este hallazgo nos llevó a realizar un cribado aleatorio de compuestos que modulen la actividad de mtCcO; Identificamos inhibidores de mtCcO, químicamente distintos de los inhibidores conocidos, incluido el monóxido de carbono, el óxido nítrico (NO) o los cianuros. Seleccionamos varios inhibidores alostéricos después de estudiar su cinética enzimática (Figuras complementarias 1a-d). Luego intentamos obtener estructuras cristalinas complejas de mtCcO y nuestros inhibidores. A partir de ahora nos centramos en T113, ya que su sitio de unión estaba enterrado dentro de una hélice específica de mamíferos, COX7C (Fig. 1a, b). Se obtuvieron datos de difracción de rayos X con una resolución de 2,2 Å a partir de un cristal de mtCcO empapado con T113. También determinamos la apoestructura de mtCcO en las mismas condiciones de preparación (Tabla complementaria 1). La estructura compleja obtenida mostró un sitio de unión al compuesto claro que proporcionó una densidad electrónica adicional en comparación con la proteína, que se encuentra claramente dentro del mtCcO (Figura complementaria 2a). El mapa diferencial Fo (T113) –Fo (DMSO) confirmó que esta densidad electrónica no se originó a partir de moléculas de agua o lípidos, y mostró la diferencia más alta (Figura complementaria 2b). El bolsillo de unión era diferente del sitio de unión del oxígeno molecular o del citocromo c, la ruta de transferencia de electrones, la vía de protones o el canal de acceso al oxígeno16,19, lo que sugiere que T113 es un inhibidor alostérico genuino.

una estructura de rayos X de mtCcO con T113. El mapa de densidad electrónica (2Fo – Fc), contorneado en 1σ, se muestra a la izquierda. A la derecha se muestra el modelo de cinta de mtCcO con T113 en la esfera. T113 estaba cubierto por COX7C (rojo), oculto desde la superficie. b T113 estaba rodeado por 4 hélices transmembrana (TM1–3, COX7C) y enterrado desde la superficie, visto desde el espacio entre membranas. La superficie molecular de la proteína se muestra en gris en la vista de primer plano. Tres hélices de la subunidad I que rodean el sitio alostérico se muestran en azul oscuro, las otras hélices de la subunidad I en azul pálido y la subunidad COX7C en mtCcO se muestra en rojo.

Tres de cada cuatro hélices que rodean el sitio alostérico de mtCcO pertenecen a la subunidad I, común en los HCO. Además, notamos que la conformación estérica de las hélices cerca del hemo de bajo espín está bien conservada en los HCO bacterianos (Fig. 2a y Fig. complementaria 3). Estas observaciones nos llevaron a suponer que podríamos detectar razonablemente inhibidores alostéricos a partir de derivados de nuestros inhibidores de mtCcO, que probablemente se dirijan al sitio alostérico correspondiente de las oxidasas bacterianas.

a Sitios alostéricos de mtCcO mitocondrial (izquierda) y bo3 UqO de E. coli (centro). Las hélices de la subunidad I se muestran en azul, TM0 de la subunidad I en violeta, la subunidad COX7C se muestra en rojo y las otras hélices en amarillo. Se muestran vistas fusionadas (derecha) con E. coli bo3 UqO en gris. COX7C está lo suficientemente cerca como para cubrir el inhibidor. Todas las hélices de la subunidad I están fusionadas entre mtCcO y E. coli bo3 UqO excepto TM0. b Detección de 434 sustancias químicas a 50 µM contra E. coli bo3 UqO. Los datos se presentan como un promedio de un duplicado. c Inhibición dependiente de la dosis de N4 específica de la actividad enzimática bo3 UqO. Los datos se presentan como un valor promedio de réplicas técnicas en dos experimentos independientes. d Análisis cinético de bo3 UqO con DMSO y molécula de N4 25 µM. Las líneas de ajuste se calculan utilizando la ecuación de Michaelis-Menten con el modelo de inhibición no competitiva. Los datos se presentan como un valor promedio de réplica técnica. La reproducibilidad fue confirmada por dos experimentos independientes. Los datos de origen están disponibles como un archivo de datos de origen.

Para la preparación de una biblioteca personalizada, aplicamos la detección de compuestos in silico originados a partir de dos inhibidores de mtCcO, incluidos T113 y T151, que obtuvimos en la detección inicial de alto rendimiento; También se descubrió que T151 se une al sitio alostérico (Figura complementaria 1d). Los compuestos estructuralmente similares a estos se recopilaron principalmente mediante múltiples algoritmos de búsqueda basados ​​en ligandos de 80 millones de compuestos disponibles comercialmente. Luego, nuestro algoritmo interno los integró, los clasificó y eligió la primera serie de 285 compuestos26,27. Agregamos el segundo conjunto de 149 compuestos elegidos mediante simulación de acoplamiento, que analizó los mismos 80 millones de compuestos contra la bolsa alostérica de mtCcO. En total, establecimos una biblioteca personalizada que consta de 434 compuestos que tienen una alta probabilidad de unirse al sitio alostérico conservado para los HCO. Probamos esta biblioteca contra mtCcO y, como resultado, 47 compuestos inhibieron mtCcO más del 40% a 50 µM (11,4%), más que la tasa de aciertos habitual de la detección aleatoria, verificando que nuestra biblioteca personalizada concentraba inhibidores de mtCcO (Figura complementaria. 4a).

Utilizamos bo3 ubiquinol oxidasa de E. coli (bo3 UqO) para probar nuestra hipótesis como modelo de HCO bacteriano. Nuestra biblioteca personalizada se analizó contra bo3 UqO y obtuvimos 15 compuestos exitosos que mostraron> 40% de inhibición para bo3 UqO a 50 µM (Fig. 2b). Entre ellos, se adquirieron con éxito ocho inhibidores comunes tanto para mtCcO como para bo3 UqO y, lo que es más importante, dos inhibidores específicos para bo3 UqO (Fig. 2c). Como se esperaba, uno de estos inhibidores, N4, se ajustaba bien a la curva inhibidora alostérica evaluada por la ecuación de Michaelis-Menten (Fig. 2d).

Para obtener evidencia directa de que N4 se une al sitio alostérico correspondiente, determinamos la estructura de bo3 UqO unido a N4 con un fragmento Fab a una resolución de 3.0 Å utilizando microscopía electrónica criogénica (crio-EM) (Fig. 3a, Fig. complementaria 5e– h, y Tabla complementaria 2). También determinamos la apoestructura de bo3 UqO a 3,1 Å en las mismas condiciones de preparación (Figuras complementarias 5a-d). Los mapas diferenciales entre holoestructuras y apoestructuras demostraron una densidad adicional explícita, y esta densidad fue la principal diferencia encontrada (Figura complementaria 5i). En particular, el sitio de unión estuvo expuesto a la superficie y adyacente a la hélice transmembrana 1 (TM1), TM2 y TM3 de la subunidad I, lo que corrobora firmemente nuestra hipótesis (Fig. 3b, c). Había enlaces de hidrógeno entre Asp75, Arg71 y N4. La superficie de potencial electrostático de los sitios de unión mostró que bo3 UqO tiene una superficie más hidrofílica que mtCcO, lo que sugiere que es poco probable que el T113 hidrofóbico se una a bo3 UqO (Fig. 3d). Mientras tanto, el N4 relativamente hidrofílico no es un aglutinante factible para el bolsillo alostérico de mtCcO, un ambiente más hidrofóbico, lo que explica que el N4 es un derivado de T113, sin embargo, son inhibidores mutuamente excluyentes de bo3 UqO o mtCcO, respectivamente. Los mutantes de los residuos de aminoácidos alrededor del inhibidor en la estructura demostraron un cambio significativo en el efecto inhibidor, lo que confirma que N4 se une definitivamente a bo3 UqO en el bolsillo (Figura complementaria 5j).

un mapa de densidad Cryo-EM (izquierda) y el modelo de cinta (derecha) de bo3 UqO en complejo con N4 (rojo a la izquierda, esfera a la derecha). El sitio alostérico de bo3 UqO queda expuesto. b Molécula de N4 en el sitio alostérico de bo3 UqO. El mapa de densidad crio-EM alrededor de N4 se muestra en rojo. Las interacciones moleculares entre Asp75, Arg71 y N4 se muestran como líneas de puntos. c N4 es accesible desde la superficie. La superficie molecular de la proteína en el plano de Fe en el hemo b se muestra en gris. Se presentó la molécula de N4 completa. d La superficie de potencial electrostático del sitio alostérico de bo3 UqO (izquierda) y mtCcO (derecha). e Inhibición del crecimiento por N4 durante un cultivo de 24 h de E. coli de tipo salvaje (salvaje), cepa knockout bo3 UqO (Δbo3) y cepa bo3 dependiente de UqO (Δbd). f Un ensayo de viabilidad dependiente del tiempo y la concentración. Una línea de puntos indica la inoculación (1 × 105 UFC/ml). Los datos se confirman por triplicado biológico (e) o duplicado (f). El color de las hélices es el mismo que en la Fig. 2. Los datos de origen están disponibles como un archivo de datos de origen.

Un inhibidor específico de los HCO bacterianos podría tener potencial como antibiótico. Para probar esta posibilidad, evaluamos la inhibición del crecimiento de E. coli por N4. En E. coli, hay dos ramas de oxidasas terminales en la cadena respiratoria, bo3 UqO y citocromo bd oxidasa (bd UqO). E. coli utiliza bo3 UqO en condiciones aeróbicas, mientras que utiliza preferentemente bd UqO en condiciones hipóxicas, como adaptación al medio ambiente28. En E. coli de tipo salvaje, no hubo efecto del N4 en el crecimiento; sin embargo, disminuyó significativamente el crecimiento de E. coli en la cepa bo3 UqO dependiente (Fig. 3e). Esta inhibición del crecimiento se canceló en la cepa knockout bo3 UqO, lo que confirma que la inhibición del crecimiento por N4 fue el resultado de la inhibición del HCO, no un efecto inespecífico. Para distinguir entre los efectos bactericidas y bacteriostáticos del compuesto, realizamos un ensayo de recuento de colonias y descubrimos que el efecto de nuestro inhibidor, N4, sobre E. coli es bacteriostático (Fig. 3f).

A continuación, para ampliar nuestros hallazgos, probamos la NO reductasa dependiente de quinol (bb3 qNOR), un miembro lejano de la familia del HCO de la bacteria patógena Neisseria. En el género Neisseria, la aparición y propagación de N. gonorrhoeae multirresistente es un considerable problema de salud mundial29. qNOR reduce el NO a óxido nitroso (N2O) y es una enzima crítica en la desnitrificación, que oxida compuestos de nitrógeno para producir energía en condiciones anóxicas30. La desnitrificación bacteriana también juega un papel vital en la protección del NO exógeno producido por las células inmunes del huésped, por lo que está implicada en la patogenicidad de varias especies bacterianas, incluidas N. meningitidis y N. gonorrhoeae31,32. Estos sugieren que qNOR en Neisseria puede ser un objetivo farmacológico. Utilizamos N. meningitidis qNOR porque las secuencias de aminoácidos de N. meningitidis qNOR y N. gonorrhoeae qNOR son 98% idénticas, especialmente 100% en la región transmembrana, y lo más importante es que se ha resuelto la estructura de N. meningitidis qNOR33. Confirmamos que la conformación estérica de tres hélices (TM 3–5 en bb3 qNOR) alrededor del hemo de bajo espín también se conserva en bb3 qNOR (Fig. 4a) 34. Empleamos el mismo enfoque para bb3 qNOR que para bo3 UqO. Primero, analizamos nuestra biblioteca personalizada contra bb3 qNOR y obtuvimos 52 compuestos exitosos que mostraron> 50% de inhibición de bb3 qNOR a 50 µM (Fig. 4b). Entre ellos, encontramos un inhibidor específico de qNOR de bb3, Q275. Q275 no se cruzó ni con mtCcO ni con bo3 UqO (Fig. 4c). Q275 no afectó la respiración celular de las células de mamíferos ni su viabilidad celular (Fig. 4d, e). Confirmamos que Q275 tiene un modo de inhibición alostérico (Fig. 4f). Además, los mutantes sustituidos con aminoácidos alrededor del sitio alostérico correspondiente de bb3 qNOR mostraron un cambio considerable en el efecto inhibidor, lo que confirma que Q275 se une a bb3 qNOR en el bolsillo (Fig. 4g).

a La conformación estérica alrededor del hemo de bajo espín se conserva en bb3 qNOR (PDB: 6fwf). Una sombra roja indica el sitio alostérico, distinto del sitio de unión del quinol. b Detección de 434 productos químicos a 50 µM en N. meningitidis bb3 qNOR (eje x) y E. coli bo3 UqO (eje y). Q275 es un inhibidor específico de bb3 qNOR, que se muestra en verde. c Inhibición específica y dependiente de la dosis de Q275 sobre la actividad qNOR de bb3. d Q275 no tiene ningún efecto sobre la tasa de consumo de oxígeno en células de mamíferos. N = 6 réplicas técnicas para cada grupo y reproducidas en dos experimentos independientes. e Q275 no muestra citotoxicidad evaluada en cardiomiocitos de rata. CAROLINA DEL NORTE; DMSO, PC; 1% Tritón X-100. N = 6 réplicas técnicas para DMSO, 3 para otros grupos. La reproducibilidad fue confirmada por dos experimentos independientes. f Análisis cinético de bb3 qNOR con DMSO y molécula Q275 10 µM. Las líneas de ajuste se calculan utilizando la ecuación de Michaelis-Menten con el modelo de inhibición no competitiva. g El efecto de la sustitución de aminoácidos de bb3 qNOR. Las posiciones de Val293, Val289 y Trp334 se muestran en (a). h Concentración inhibidora mínima (CMI) de Q275 frente a la cepa de referencia F de la OMS de N. gonorrhoeae y una FC428 resistente a la ceftriaxona. Se añadió nitrito de sodio (20 mM) para imitar una condición de NO. Los datos representan experimentos duplicados. i Recuento de colonias 24 h después del tratamiento con Q275 de N. gonorrhoeae WHO F, FC428 y norB deficiente de ambas cepas. Se añadió nitrito de sodio (20 mM) para imitar una condición de NO. Una línea de puntos indica la inoculación (5 × 105 UFC/ml). c, f, g Los datos se presentan como un valor promedio de réplicas técnicas en tres (f, g) experimentos independientes. Los datos de origen están disponibles como un archivo de datos de origen.

Finalmente, probamos el efecto antimicrobiano de Q275 contra una cepa clínicamente aislada de N. gonorrhoeae que tiene resistencia a ceftriaxona (FC428); La propagación de la superresistente N. gonorrhoeae se ha convertido en un grave problema de salud mundial4. En particular, Q275 demostró efectos antimicrobianos contra FC428, así como contra la cepa de referencia (OMS F) en condiciones de desafío para NO (ataque de células inmunes), imitando el ambiente intravital infeccioso (Fig. 4h). Establecimos cepas deficientes en norB, que codifican qNOR, tanto en entornos WHO F como FC428. En condiciones de desafío a NO (NaNO2 20 mM), las cepas deficientes en norB tanto en WT como en FC428 no crecieron, lo que respalda aún más que la inhibición del crecimiento está mediada por qNOR. Para distinguir entre efectos bactericidas y bacteriostáticos utilizando estas cepas deficientes en norB, realizamos un recuento de colonias después de la exposición a NaNO2 y descubrimos que apuntar a qNOR en N. gonorrhoeae es bacteriostático (Fig. 4i). Estos resultados sugieren que nuestro enfoque desarrolló un inhibidor específico contra un HCO bacteriano patógeno bajo demanda con un rango estrecho de especificidad, que tiene el potencial terapéutico para abordar la RAM.

A continuación nos centramos en el mecanismo inhibidor. El sitio de unión de T113 en mtCcO formó un túnel estrecho rodeado por cuatro hélices en total (Fig. 1b). El mapa diferencial Fo(T113)-Fo(DMSO) reveló varias diferencias en la estructura de mtCcO desencadenadas por la unión del inhibidor: el sitio de salida de la vía de protones (Asp50, Asp51), una cadena lateral de Ser382 de TM10 en la subunidad I, y el grupo hidroxifarnesiletilo del hemo a (Figura complementaria 2b). Estos son los sitios donde se ha informado de cambios estructurales entre las formas reducida y oxidada de mtCcO, lo que plantea la posibilidad de que T113 haya reducido mtCcO35. Para probar esta posibilidad, analizamos la firma de mtCcO reducida a través de ditionito o por T113. En comparación con un estado completamente reducido inducido por ditionito, el mtCcO mezclado con T113 mostró una firma mínima de cambio reductor en la banda de Soret y un aumento en los espectros de absorción de alrededor de 600 nm, que son características distintivas de los hemos reducidos, lo que sugiere que T113 no es un reactivo reductor. (Figura complementaria 6). Por tanto, el cambio estructural que observamos no explica completamente el mecanismo de inhibición.

En el mecanismo de la alosteria, una unión efectora transmite la señal al sitio funcional, el sitio ortostérico, mediante una transición de conjuntos conformacionales, que a menudo es difícil de capturar mediante análisis estructural debido a su naturaleza instantánea o posible restricción en la cristalización36. Por lo tanto, para obtener una visión mecanicista, aplicamos una simulación de dinámica molecular (MD) de mtCcO con o sin inhibidor. En general, las simulaciones de MD con el inhibidor (holo-MD) no mostraron deformaciones estructurales significativas. En particular, las trayectorias promedio con el inhibidor mostraron que TM2 de la subunidad I, una de las cuatro hélices que forman el bolsillo de unión del inhibidor, se dobló en la dirección de TM5/6, aunque TM3 no cambió entre las holo- y apo-MD (Fig. .5a-c). Este movimiento sugiere que el canal de oxígeno molecular, la cavidad hidrofóbica rodeada entre TM2/4 y TM5/6, está restringido. El holo-MD demostró que la distancia entre Glu242 e Ile66, los cuales miran al canal de oxígeno y forman una sección transversal mínima, se hizo más estrecha en presencia del inhibidor. Por el contrario, la distancia entre Ile312 y Val287, que dan a un camino de salida para el agua producida, no cambió (Fig. 5c, d). Además, realizamos simulaciones adicionales con la eliminación del ligando después de la MD unida al ligando (Re-apo MD). Re-apo MD demostró que TM2 se relajó hasta la estructura apo inicial, aunque el cambio en el canal de oxígeno no se relajó durante el Re-apo MD, lo que sugiere que el efecto sobre TM2 del inhibidor que está al lado de TM2 es más directo que sobre TM2. el canal de oxígeno. Estos datos sugirieron que T113 podría interferir con el acceso de oxígeno al BNC, inhibiendo así la reacción enzimática.

a Ejes de TM2 y 3 en una instantánea representativa de una trayectoria de apo-MD, holo-MD y Re-apo MD. Los ejes fueron calculados mediante herramientas UCSF Chimera y representados por cilindros. Las moléculas de hemo a y T113 se mostraron como barras verdes. b Histogramas de distribución del ángulo para TM2 y 3. c La región enfocada en la simulación MD. CAVER calculó las trayectorias del canal de oxígeno (rojo) y del canal de agua (verde) y se muestran como esferas continuas. TM1-6 en la subunidad I se muestra en azul oscuro y las otras hélices de la subunidad I en azul pálido, la subunidad COX7C en mtCcO se muestra en rojo y las otras hélices en amarillo. d Histogramas de distribución de la distancia entre Glu242-Ile66 en el canal de oxígeno y la distancia entre Ile312-Val287 en el canal de agua. Las flechas muestran el movimiento de TM2 por T113 en (a, c). Las líneas de puntos en b y d muestran el valor mediano. e Los espectros Raman de resonancia excitada de 441,6 nm de hemos de mtCcO ((i), (iii)) sin y ((ii), (iv)) con N62. La muestra de mtCcO se irradió con láser dos veces con 10 minutos de incubación en oscuridad en el medio. Los espectros ((1); azul) y ((2); verde) se obtuvieron de 0 a 3 y de 27 a 30 minutos en la primera irradiación de 30 minutos. Después de 10 minutos de incubación en oscuridad, se obtuvieron espectros ((3) negro) y ((4) rojo) de 0 a 3 minutos y de 27 a 30 minutos en la segunda irradiación de 30 minutos. La potencia del láser fue de 1 mW para ((i), (iii)) y 0,1 mW para ((ii), (iv)). f Un experimento de flujo detenido mostró que N62 inhibía la unión de CO a CcO cinco veces más lentamente que el control. Los cambios de absorbancia a 440 nm están asociados con la unión de CO al mtCcO reducido. g Cambios de absorbancia a 430 nm asociados con la unión de CO a la bo3 UqO reducida de tipo salvaje. Las líneas de ajuste se calculan mediante un modelo de decaimiento monofásico. El rango de datos se presenta como una desviación estándar de cuatro réplicas para CcO y tres réplicas para bo3 UqO. Los datos de origen están disponibles como un archivo de datos de origen.

Para probar si T113 tiene un efecto alostérico en el canal de oxígeno, realizamos espectroscopia Raman de resonancia, un método sensible para detectar cambios estructurales que no pueden evaluarse mediante análisis estructural de cristales de rayos X. Como T113 tiene autofluorescencia, seleccionamos sus derivados y elegimos N62 debido a su mayor afinidad sin autofluorescencia (Fig. 4b, c complementaria). Confirmamos que N62 se unió al mismo sitio de unión en cocristalografía (Figura complementaria 4d) y dio una pequeña diferencia de alrededor de 440 nm en la absorción del hemo similar a la de T113 (Figura complementaria 4e). Utilizamos N62 para los análisis espectroscópicos Raman a partir de ahora. Anteriormente, se informó que la luz visible induce la fotorreducción de mtCcO, donde inicialmente se reduce el hemo a, seguido del hemo a337. La Figura 4e muestra los espectros de resonancia Raman de mtCcO con y sin N62, centrándose en la fotorreducción de los hemos. La banda de resonancia Raman en 1356/1372 cm−1 es asignable al modo ν4 de los hemos (heme a y hemo a3), un indicador del estado redox: 1356 cm−1 para el estado reducido, 1372 cm−1 para el estado oxidado38. En condiciones de control sin N62, la irradiación con láser a una potencia de 1 mW demostró la fotorreducción de hemos. Cuando se detuvo la irradiación, el oxígeno disponible provocó la restauración de los hemos oxidados, invirtiendo las bandas marcadoras redox. La reirradiación con el láser demostró una reducción de los hemos nuevamente (Fig. 5e (i)). Por el contrario, mtCcO con N62 mostró un comportamiento de fotorreducción diferente. Con N62 se observó una reducción comparable de los hemos con una potencia láser baja de sólo 0,1 mW. En particular, la interrupción de la irradiación con láser no disminuyó la banda marcadora de reducción y la reirradiación mostró un aumento adicional (Fig. 5e (ii)). Estos datos indican que el N62 inhibe la reoxidación de los hemos fotorreducidos por el oxígeno. Para probar la unión de oxígeno más directamente, a continuación analizamos el modo de estiramiento Fe-His (νFe-His) del hemo a3, el sitio de unión de oxígeno, a 215 cm-1, que representa el estado reducido coordinado en 5 del hemo a3. Las bandas de 215 cm-1 desaparecerán cuando el oxígeno molecular se una al hemo a3. mtCcO sin N62 mostró un ciclo de aumento/disminución de la banda de 215 cm-1 (Fig. 5e (iii)); sin embargo, mtCcO con N62 demostró un aumento continuo en la banda de 215 cm-1 (Fig. 5e (iv)), lo que proporciona una evidencia experimental de que N62 inhibe la unión del oxígeno al hemo a3. La inhibición de la reoxidación del hemo a3 por el oxígeno reduce el umbral de la fotorreducción, lo que indica que el cambio estructural en el cristal de mtCcO fue presumiblemente causado por la reducción inducida por rayos X durante la adquisición de datos.

Para fortalecer aún más el efecto del inhibidor sobre el canal de oxígeno, realizamos un experimento de flujo detenido en el que pudimos evaluar directamente el acceso de monóxido de carbono (alternativa al oxígeno molecular) al centro binuclear39. Como se muestra en la Fig. 5F, N62 inhibió la unión de CO a CcO cinco veces más lento que el control. Por lo tanto, llegamos a la conclusión de que la inhibición alostérica en el canal de acceso al oxígeno juega un papel importante en la inhibición de mtCcO.

Es posible que el alosterio que encontramos en mtCcO también se conserve entre los HCO bacterianos y sus inhibidores. Para ello, creamos una única sustitución de aminoácido en los aminoácidos que se enfrentan al canal de oxígeno de bo3 UqO, que puede ser manipulado genéticamente. Entre los mutantes realizados, las sustituciones menos voluminosas de Glu286 y Phe112, que corresponden a Glu242 y Phe67 en mtCcO (Figs. 3c y 5c), redujeron el efecto inhibidor de N4 (Fig. 6c complementaria). Además de obtener evidencia directa, realizamos un experimento de flujo detenido con bo3 UqO. Como el N4 tiene una absorbancia de entre 400 y 450 nm, utilizamos N62 para este experimento. N62 es un derivado de T113 y un inhibidor común tanto para mtCcO como para bo3 UqO. Primero, confirmamos que el efecto inhibidor de N62 sobre bo3 UqO también fue reducido por los mutantes en el canal de oxígeno al igual que N4 (Figura complementaria 6d). Un experimento de flujo detenido con bo3 UqO demostró que el inhibidor también ralentizó la unión de CO en bo3 UqO, como lo hizo en mtCcO (Fig. 5g). En conjunto con estos análisis multimodales, llegamos a la conclusión de que nuestros inhibidores de HCO obstruyen alostéricamente la entrada de oxígeno molecular/NO al BNC mediante un cambio conformacional de una hélice transmembrana de la subunidad I, inhibiendo así la función de HCO.

Los medicamentos con un modo de acción único son fundamentales para ampliar nuestras opciones antimicrobianas para superar la resistencia a los antimicrobianos, especialmente en los casos en que los patógenos, incluido N. gonorrhoeae, han adquirido resistencia a todos los antibióticos actualmente disponibles, se están propagando a nivel mundial y serían intratables40. La cadena respiratoria ha sido un posible objetivo para el desarrollo de antibióticos; Los inhibidores alostéricos son más deseables que los ortostáticos para minimizar el riesgo de efectos secundarios, considerando la importancia de la cadena respiratoria en la vida. Aquí, identificamos alosterio conservado en HCO y una hélice adicional que solo se encuentra en mtCcO eucariótico. Esta diferencia estructural en el alosterio nos permitió aislar los inhibidores específicos de dos HCO bacterianos diferentes, incluido un antibiótico contra N. gonorrhoeae resistente a la ceftriaxona, que es una de las cinco amenazas urgentes en el informe de 2019 de los Centros para el Control y la Prevención de Enfermedades3. .

Este estudio es una prueba de concepto y el compuesto aún se encuentra en la etapa inicial de desarrollo de fármacos; sin embargo, nuestros hallazgos allanarán el camino para el desarrollo de antibióticos con un mecanismo de acción diferente. La comparación de las estructuras publicadas de los HCO reveló que la conformación estérica alrededor del hemo de bajo espín está muy conservada en todos los HCO de bacterias, levaduras, plantas y mamíferos (Figura complementaria 3)41, lo que sugiere que el sitio alostérico identificado por Es probable que nos conservemos. Por lo tanto, nuestro enfoque puede generar inhibidores específicos, antibióticos potenciales, para cada HCO bacteriano bajo demanda con un rango estrecho de especificidad. El desarrollo de agentes de espectro reducido está en línea con el requisito actual de minimizar el efecto sobre el microbioma del huésped y prevenir la resistencia generalizada42. Puede que atacar los HCO no sea sencillo, ya que las bacterias patógenas a menudo tienen múltiples oxidasas terminales en su cadena respiratoria. Por lo tanto, un inhibidor de HCO deseable como antibiótico es aquel que se dirige específicamente a una etapa infecciosa particular donde los patógenos requieren de manera crítica que el HCO se adapte al entorno de crecimiento43, como hemos demostrado qNOR como un objetivo terapéutico para N. gonorrhoeae en este estudio, o Se puede utilizar con otros antibióticos como terapia combinada. Nuestros resultados sugieren que los efectos del inhibidor de UqO en E. coli y del inhibidor de qNOR en N. gonorrhoeae fueron ambos bacteriostáticos. Aunque la acción bactericida parece preferible, rara vez se ha documentado la superioridad de la acción bactericida sobre la bacteriostática44. Se necesitan más investigaciones y desarrollo de inhibidores de HCO para llegar al ámbito clínico.

Una de las cuatro hélices de mtCcO que rodean el bolsillo alostérico es la subunidad codificada por el genoma COX7C, que cubre la superficie como si ocultara el sitio alostérico. Nuestro análisis filogénico indicó que el sitio alostérico de los antiguos HCO estaba expuesto y ha sido sellado en HCO mitocondriales eucarióticos durante la evolución molecular (Figura complementaria 7). La subunidad específica de eucariotas podría proteger a mtCcO del acceso a inhibidores, o podría haber un inhibidor endógeno que regule negativamente la actividad de mtCcO en un momento específico. El papel evolutivo de la subunidad adquirida requiere más investigación.

Combinados con experimentos de flujo detenido, espectroscopia de resonancia Raman y análisis de mutantes, llegamos a la conclusión de que nuestros inhibidores de HCO obstruyen alostéricamente la entrada de oxígeno molecular/NO al BNC mediante un cambio conformacional de una hélice transmembrana de la subunidad I, inhibiendo así la función de HCO. Sin embargo, en particular en el caso de bo3 UqO, el sitio de unión de N4 es el sitio de unión de quinol. La estructura UqO de quinona-bo3 confirma que N4 ocupa el espacio donde se une el sustrato45. Asp75 y Arg71 son los mismos aminoácidos N4 utilizados para la interacción molecular que la quinona45, lo que sugiere que N4 inhibe bo3 UqO al obstruir la unión del sustrato. Estos hallazgos sugieren que el espacio rodeado por TM0 y TM1–3 de bo3 UqO funciona como un sitio de unión al sustrato y como un sitio de inhibición alostérica que propusimos. TM0 solo está presente en quinol oxidasas, incluida bo3 UqO. Estabiliza eficazmente el ubiquinol hidrofóbico en la región transmembrana para que bo3 UqO pueda usarse como sustrato; la existencia de TM0 hace que la familia de las ubiquinol oxidasas sea única. TM0 no se encuentra en otros tipos de HCO, en los que el sitio alostérico que propusimos es distinto del sitio de unión al sustrato, como se muestra en qNOR que no tiene TM0.

Con respecto a mtCcO, demostramos que el mecanismo inhibidor de la entrada de oxígeno juega un papel importante en la inhibición de T113 y N62 para mtCcO; sin embargo, también podrían estar involucrados otros mecanismos inhibidores, como en el caso que analizamos para N4 sobre bo3 UqO. Encontramos el cambio estructural en Asp50/51 y Ser382 en la estructura cristalina mtCcO-T113. Razonamos que fue causado por la fotorreducción durante la preparación de la muestra y la reducción inducida por la radiación por las siguientes razones. (1) el cambio en Asp50/51 y Ser382 se encuentra en la forma reducida de la estructura CcO; sin embargo, la simple adición de T113 no provocó la reducción de CcO (Figuras complementarias 6a, b). (2) la irradiación con láser durante la adquisición de datos Raman provocó una reducción de CcO. La Figura 5e sugiere que el inhibidor de mtCcO redujo el umbral de fotorreducción. (3) La simulación de MD con el inhibidor no causó el cambio estructural en Asp50/51 (Figura complementaria 6e). Estas observaciones, sin embargo, no eliminaron la posibilidad de que la unión de T113 induzca el cambio estructural encontrado en Asp50/51 y Ser382. El cambio en estos residuos podría afectar el bombeo de protones o la transferencia de electrones; Asp50/51 y Ser382 son residuos esenciales para el bombeo de protones, especialmente en mtCcO, formando el canal de H como sugieren Yoshikawa et al.16, aunque el canal de H solo se encuentra en mtCcO. Rich y colegas indicaron que el canal H funciona como pozo dieléctrico17. Además, el grupo Sharma informó recientemente que el cambio conformacional en el dominio portador de Ser382 afecta la transferencia de electrones46. Por tanto, la perturbación en la región puede provocar la inhibición del bombeo de protones o la transferencia de electrones. Se justifica realizar más estudios.

Nuestra simulación MD de 100 ns nos dio una pista importante sobre el mecanismo alostérico del inhibidor de mtCcO; sin embargo, Re-apo MD no demostró que el canal de oxígeno relaje la apo. Es posible que se necesite una MD más prolongada para aclarar los detalles del mecanismo molecular.

Nuestro enfoque se puede aplicar para encontrar moduladores alostéricos en otros objetivos terapéuticos. Las enzimas generalmente adquieren dominios o subunidades adicionales a lo largo de la evolución molecular22,23. Como la cadena respiratoria en la bioenergética es fundamental y esencial para la vida, las enzimas respiratorias distintas de los HCO también se conservan entre las especies, al igual que sus estructuras centrales. El tamaño de la molécula de estas enzimas respiratorias es mayor en los eucariotas que en sus homólogos bacterianos. Probablemente podrían contener alosterio dentro de la proteína en el límite de las estructuras entre eucariotas y bacterias, lo que llevaría al desarrollo de antibióticos, ya que la cadena respiratoria es un objetivo comprobado para los antibióticos. Además, cualquier molécula fundamental esencial para la vida y conservada entre especies podría ser un objetivo potencial. Además, los péptidos adicionales podrían contener un sitio alostérico positivo en el borde de su estructura central; un modulador alostérico positivo para la enfermedad humana por pérdida de función podría ser una dirección terapéutica.

Generalmente, la búsqueda de un sitio alostérico es un desafío, requiere un trabajo experimental considerable para cada proteína objetivo y es difícil de aplicar a otras. El concepto de alosterio conservado enterrado ayudará a desarrollar un enfoque sistemático, que ha sido deseado críticamente. El número de estructuras proteicas ha aumentado considerablemente con la aparición de la crio-EM y avances recientes en la predicción estructural como Alphafold2 y RoseTTAfold47,48. La comparación de estructuras de proteínas entre especies, no solo estructuras estáticas sino también conjuntos generados por MD, acelerará la búsqueda de sitios alostéricos conservados enterrados. En conclusión, este estudio abrirá nuevas vías en la ciencia de las proteínas y el desarrollo terapéutico, especialmente para antibióticos con diferentes mecanismos de acción.

La solución y los cristales de citocromo c oxidasa de corazón bovino se prepararon como se describe en un estudio previo49. Antes de la congelación, los cristales se trataron con compuesto 2 mM o DMSO en el medio final.

Los experimentos de rayos X se llevaron a cabo en las líneas de luz SPring-8 BL26B1/B2. El procesamiento y escalado de los datos de difracción se llevaron a cabo utilizando XDS50. MOLREP51 calculó la fase inicial utilizando un modelo de código PDB 5B1A después de eliminar las moléculas no proteicas. Para mejorar la densidad y eliminar el sesgo del modelo, se realizó el método de máxima entropía en Phenix52. Para el cálculo del mapa de densidad electrónica diferencial entre con y sin compuesto, se utilizó el cálculo del mapa Fo-Fo en CNS53 con un modelo sin ligando. La reconstrucción se realizó utilizando COOT54. Los modelos se refinaron con REFMAC555 y phenix.refine56 con los parámetros atómicos revisados ​​por el Dr. Tomitake Tsukihara. Para eliminar el sesgo del modelo, todos los mapas de densidad electrónica utilizados en la reconstrucción se calcularon con el modelo de compuestos omitidos. Los mapas de densidad electrónica se confirmaron con muestras replicadas. La estática de refinamiento se proporciona en la Tabla S1.

El mtCcO purificado y los compuestos se incubaron en placas de 96 pocillos a 30 °C durante 30 minutos en tampón de ensayo (pH 7,4, fosfato de potasio 50 mM, albúmina sérica bovina al 0,1%, Lyso PG al 0,025% 14:0). Para iniciar la reacción enzimática, se añadió citocromo c reducido (1,5 µM) a la mezcla y luego las placas se leyeron a 550 nm usando un lector de placas. Se calculó la pendiente durante 60 s y el cambio en la actividad de mtCcO se exportó comparándolo con la muestra tratada con DMSO como control negativo.

Se prepararon soluciones de mtCcO para espectroscopia con mtCcO 15 µM con y sin N62 50 µM en tampón fosfato de sodio 60 mM y n-decil-β-d-maltósido al 0,2% (pH 6,8) y sus espectros se midieron a 4 °C a menos que se indique lo contrario. . Los espectros de absorción se midieron en una cubeta de 3 mm de recorrido con un espectrofotómetro (lamda650, PerkinElmer). Los espectros se presentaron con valores de absorbancia equivalentes a 1 cm. El mtCcO oxidado se midió bajo aire y el mtCcO reducido con ditionito se midió bajo N2. Los espectros de resonancia Raman se midieron en una celda giratoria a 2000 rpm con una longitud de onda de excitación de 441,6 nm (un láser HeCd, Kimmons). La luz dispersada Raman se detectó mediante un espectrómetro Raman (500M, SPEX) conectado con CCD (Symphony II, Horiba) con una geometría de dispersión de 90°. Se preparó una solución de mtCcO oxidada en reposo para mediciones Raman y se transfirió a la celda de hilado sellada con un tabique de goma en una caja de guantes (MM3-H60S, MIWA) a un nivel de oxígeno inferior a 100 ppm. El tampón usado y el tabique de caucho se desgasificaron y se incubaron en la caja con guantes durante la noche. La solución de muestra así preparada contenía solo una pequeña cantidad de oxígeno residual, lo que aseguró la observación de una fracción de hemo a3 reducida de cinco coordenadas en la medición de fotorreducción, evitando al mismo tiempo la oxidación total inmediata de todo el hemo a3.

El sistema modelo se construyó a partir de la estructura cristalina de mtCcO bovino reducido (código de identificación PDB 3AG2) para realizar simulaciones de MD de todos los átomos. Se eliminaron todas las moléculas de agua cristalina presentes en la estructura atómica del código de identificación 3AG2 de PDB. Los átomos de hidrógeno faltantes de los sistemas se agregaron con el programa tleap en AmberTools 2020 (ref: https://ambermd.org/CiteAmber.php). En las simulaciones MD se adoptaron el campo de fuerza Amber ff14SB para proteínas, agua e iones57, y el campo de fuerza Amber lipid14 para lípidos58. Todo el mtCcO monomérico de 13 subunidades se sumergió en una bicapa lipídica formada por 50% de fosfatidilcolina y 50% de fosfatidiletanolamina usando CHARMM-GUI59. Luego, la proteína con bicapas lipídicas se solvató con el modelo de agua TIP3P en cajas rectangulares. Las cajas se prepararon con márgenes de 20 Å de separación de cada proteína para evitar efectos artificiales por sus imágenes repetidas periódicamente. Los parámetros para centros metálicos y aminoácidos se obtuvieron de un estudio anterior60. Brevemente, se oxidaron CuA y hemo a y se redujeron hemo a3 y CuB. Los estados de protonación de los residuos se determinaron mediante el método del continuo electrostático. Los estados de protonación de los residuos importantes son los siguientes: todas las propionas de los hemos a y a3 fueron desprotonadas, Arg438 y 439 fueron desprotonadas, Asp364 y ​​Glu242 fueron desprotonadas, His290 e His291 fueron protonadas en la posición δ. Para neutralizar cada sistema con contraiones, se seleccionaron aleatoriamente algunas moléculas de agua y se reemplazaron con un conjunto de iones Na+ o Cl-. Se empleó el método de Ewald de malla de partículas (PME) para las interacciones de Coulomb61. Todas las simulaciones de MD se realizaron utilizando el software GROMACS 201962. Todo el sistema membrana-proteína-disolvente constaba de 302.004 átomos para apo-MD y 302.029 átomos para holo-MD. Las simulaciones de MD se realizaron en un conjunto NPT constante (300 K y 1 atm) utilizando un paso de tiempo de 2 fs.

Se consideraron los siguientes tratamientos (a – c) para equilibrar cada sistema: (a) La minimización de energía se realizó durante 10 000 pasos. (b) Se realizó un equilibrio MD de 100 ps con el termostato V-rescale63 a 300 K bajo 1 atm, y (c) se realizó un equilibrio MD de 100 ps con el acoplamiento Berendsen64 a 300 K bajo 1 atm. Cada instantánea se grabó cada 1 ps65. Finalmente, se realizó una simulación MD de 100 ns en un conjunto NPT constante (300 K y 1 atm) como ejecuciones de producción y los últimos 80 ns se utilizaron como análisis. Para obtener trayectorias estadísticamente confiables, realizamos tres ejecuciones con diferentes velocidades iniciales para las apo u holoestructuras.

Para el primer grupo, calculamos el coeficiente de Tanimoto entre cuatro inhibidores de mtCcO y cada uno de los 80 millones de compuestos disponibles comercialmente sobre la base de huellas dactilares 2D (claves MACCS, ECFP4, FCFP4 y GpiDAPH3) y métricas de forma 3D (ComboScore) con el software. Pipeline Pilot (BIOVIA, Dassault Systèmes), MOE (Chemical Computing Group) y ROCS (OpenEye Scientific Software). Los compuestos que mostraban valores altos del coeficiente de Tanimoto se agruparon mediante la huella digital ECFP4 y luego se seleccionaron los compuestos en el centro de cada grupo para el ensayo enzimático. Para el segundo grupo, la estructura del complejo mtCcO/T113 se preparó adecuadamente utilizando un asistente de preparación en Schrödinger suite 2016-1 (Schrödinger, LLC), y luego se realizó una generación de rejilla receptora para el protocolo de acoplamiento. 80 millones de compuestos disponibles comercialmente se sometieron a acoplamiento molecular contra mtCcO utilizando Glide 7.0. Los compuestos seleccionados según la puntuación Glide, que comparte el mismo espacio que T113 en el complejo, se agruparon mediante la huella digital ECFP4 y luego se seleccionaron los compuestos en el centro de cada grupo para el ensayo enzimático. Finalmente, se seleccionaron y compraron 434 compuestos.

El plásmido que codifica bo3 UqO con una etiqueta His en el extremo carboxilo terminal en la subunidad II fue un regalo del laboratorio Gennis66. bo3 UqO se purificó según el método descrito anteriormente67. Brevemente, el plásmido se transformó en la cepa C43 (DE3) Δcyo E. coli y las células se cultivaron en un medio M63. bo3 UqO se solubilizó con n-dodecil-β-d-maltósido (C12M) al 1% y se purificó con resina TALON, resina Super-Q y cromatografía de exclusión por tamaño, y luego se almacenó en un tampón que contenía Tris-HCl 25 mM, 200 NaCl mM y C12M al 0,02 % (pH 7,5) a una concentración de 10 a 15 mg/ml.

La bo3 UqO de E. coli purificada se reconstituyó en liposomas (fosfatidilcolina de yema de huevo: lípido polar de E. coli = 3:1). Se inmunizaron ratones BALB/c hembra cinco veces con dosis de 0,1 mg de bo3 UqO reconstituida con 50 µg de lipopolisacárido, a intervalos de 7 días. Se prepararon suspensiones unicelulares a partir del bazo de los ratones inmunizados y las células se fusionaron con células de mieloma P3U1, utilizando el método convencional de polietilenglicol (PEG)68. La detección de anticuerpos se realizó mediante tres métodos: ensayo inmunoabsorbente ligado a enzimas de liposomas (L-ELISA), ELISA desnaturalizado (D-ELISA) y cromatografía de exclusión por tamaño (SEC)69. Para L-ELISA, la bo3 UqO purificada se reconstituyó en liposomas que contenían biotinilo-PE y se inmovilizó en placas Immobilizer Streptavidin (Nunc). SEC seleccionó anticuerpos de alta afinidad que formaron complejos estables con bo3 UqO purificado en una columna Superdex 200 5/150 (GE Healthcare). Los anticuerpos que reconocían la conformación nativa de E. coli bo3 UqO se analizaron mediante D-ELISA con E. coli bo3 UqO desnaturalizada con SDS. Se aislaron tres clones seleccionados mediante el método de cultivo de dilución limitante y se establecieron líneas celulares de hibridoma monoclonal que producen anticuerpos anti-bo3 UqO. El fragmento Fab de un anticuerpo monoclonal anti-bo3 UqO se preparó como se describe69. Las proteínas bo3 UqO purificadas se mezclaron con el fragmento Fab durante 24 h a 4 ° C, y los complejos bo3 UqO-Fab se purificaron mediante SEC, seguido de incubación con N4. Probamos tres clones mediante crio-EM y seleccionamos uno para la determinación estructural.

La UqO purificada y los compuestos se incubaron en placas de 96 pocillos a 25 °C durante 60 minutos en tampón de ensayo (pH 7,4, fosfato de potasio 50 mM, ácido etilendiamina-N',N',N',N'-tetraacético 1 mM (EDTA ), 0,1% albúmina sérica bovina, 0,15% C12M). Para iniciar la reacción enzimática, se añadió a la mezcla una cantidad reducida de UQ-1 40 µM, luego las placas se leyeron a 278 nm usando un lector de placas. Se calculó la pendiente y se exportó el cambio de actividad enzimática comparándolo con la muestra tratada con DMSO como control negativo.

Se aplicó una muestra de 3 µl a una rejilla Quantifoil descargada por luminiscencia (malla R1.2/R1.3 300, cobre), se secó con 100 % de humedad a 8 °C y se sumergió en etano líquido usando Vitrobot MkIV. El análisis Cryo-EM se realizó inicialmente utilizando un microscopio Talos Arctica a 200 kV con un detector Falcon3 en KEK. La recopilación de datos se realizó utilizando un microscopio Glacios con un detector Gatan K2 Summit en el modo de conteo en RIKEN SPring-8. Las películas se adquirieron con un aumento de ×45.000 con una dosis acumulada de 50,0 electrones por Å2 en 40 fotogramas. El tamaño de píxel fue de 0,889 Å. Los datos se adquirieron automáticamente mediante el método de desplazamiento de imagen del haz utilizando el software SerialEM70.

El procesamiento de datos Cryo-EM se realizó utilizando RELION 3.171. Las pilas de películas sin procesar se corrigieron en movimiento utilizando MotionCor272 de la propia implementación de RELION. Los parámetros CTF se determinaron utilizando el programa CTFFIND473. Los flujos de trabajo de procesamiento de datos para UqO (12,388 pilas de películas de Glacios) y UqO/complejo compuesto (7173 pilas de películas de Glacios) se resumen en las figuras S3A-H, respectivamente. La resolución final se estimó mediante la correlación de capa de Fourier (FSC) estándar de oro entre los dos medios mapas refinados de forma independiente (FSC = 0,143). Para la construcción del modelo contra el mapa EM, se generó un modelo inicial mediante modelado de homología con el conjunto de programas MOE (MOLSIS Inc.) y se acopló al mapa final utilizando Chimera74. Luego, el modelo se refinó manualmente utilizando el programa COOT54. El refinamiento del espacio real en el programa Phenix se realizó con los parámetros atómicos de los hemos revisados ​​a partir de los predeterminados52. En la Tabla S2 se proporciona un resumen de los parámetros del modelo y las estadísticas del mapa crio-EM.

E. coli se cultivó durante la noche en medio LB y se diluyó hasta una DO600 de 0,0132. Se añadieron 5 µl de células a cada pocillo de la placa de 96 pocillos y se trataron con un compuesto a concentraciones de 128 µg/ml o diluciones en serie al doble en 100 µl de medio LB. Luego las placas se incubaron a 37 °C durante 24 h sin agitación y se leyeron a 600 nm utilizando un lector de placas para cuantificar el crecimiento celular. La tinción C43 (DE3) y C43 (DE3) Δcyo fueron proporcionadas por el Dr. Yoshio Nakatani y se utilizaron como cepa de tipo salvaje y cepa bo3 UqO-knockout, respectivamente. C43 (DE3) ΔcydΔappx fue proporcionado por el Dr. Robert Gennis y utilizado para la cepa bo3 UqO dependiente. Como N4 a 32 µg/ml demostró inhibición del crecimiento en el ensayo anterior, realizamos un ensayo de viabilidad dependiente del tiempo y la concentración a 32, 128 µg/ml de N4. Se preparó un inóculo de aproximadamente 1 × 105 UFC/ml y luego se incubó a 37 °C sin agitación. Las colonias supervivientes se contaron en tiempos fijos (12, 24, 48 y 72 h).

Neisseria meningitidis bb3 qNOR fue proporcionada por el laboratorio Shiro. La expresión y purificación se realizaron como se informó anteriormente con modificación34.

Para las pruebas de susceptibilidad a los antimicrobianos se utilizaron la cepa de referencia de N. gonorrhoeae F75 de la OMS y una FC42876 resistente a la ceftriaxona. N. gonorrhoeae se cultivó en medio GW con 5% de CO2 a 37 °C sin agitación77. Subcontratamos la preparación del medio al Instituto de Investigación de Péptidos Funcionales Co., Ltd. Se utilizó el método MIC de dilución en microcaldo para medir cuantitativamente la actividad antibacteriana in vitro de Q275 contra las cepas bacterianas. La concentración más baja de antibiótico que impidió el crecimiento se interpretó como CMI. Se añadió nitrito de sodio (20 mM) al medio para imitar una condición desafiante para el NO (ataque de células inmunes). Para el ensayo de recuento de colonias, preparamos un inóculo de alrededor de 5 × 105 UFC/ml y luego lo incubamos a 37 °C durante 24 h sin agitar. Se contaron las colonias supervivientes.

Los mutantes de Neisseria gonorrhoeae se construyeron como se describió anteriormente78. Brevemente, para construir el mutante deficiente en norB de N. gonorrhoeae, se amplificó un fragmento de ADN de 4,3 kb del ADN cromosómico FA1090 de N. gonorrhoeae que contenía el gen norB con los cebadores norB-1 y norB-2 mediante la ADN polimerasa PrimeSTAR Max ( Takara Bio) y se clonó en el sitio SmaI del vector pMW119 (4,2 kb) (gen Nippon) para construir pHT1729 (8,5 kb). La región de ADN de 6,5 kb de pHT1729 se amplificó con los cebadores norB-3 y norB-4 mediante la ADN polimerasa PrimeSTAR Max y se ligó con un gen de resistencia a kanamicina (kan) para construir pHT1739. Un fragmento de ADN de 3 kb que contenía el alelo norB, en el que el gen estructural norB fue reemplazado por el gen kan, se amplificó con los cebadores norB-1 y norB-2 de pHT1739, y se transformó en cepas de N. gonorrhoeae y en clones resistentes a kanamicina. seleccionados, dando como resultado mutantes deficientes en norB. Los cebadores utilizados son,

norB-1TCGAGCTCGGTACCCGATGTAGAACTCTTTATCCACTTTCGGCAG

norB-2CTCTAGAGGATCCCAGGCGGGCAGCCGCCGTTTCCAACGGTTTG

norB-3GGGAAAACCCTGGCGGTTTTAGCCTGAAAATGGAAACCG

norB-4CATAGCTGTTTCCTGTTTGAGAGCTCCTTTTAATAAATC

Para preparar la enzima completamente reducida, se incubó alternativamente una solución de enzima (1 µM de mtCcO o 0,5 µM de bo3 UqO), mezclada con DMSO o N62 200 µM, bajo presión de vacío y atmósfera de N2, luego se redujo con ditionito. Se preparó una solución de CO incubando alternativamente bajo presión de vacío y una atmósfera de 20% de CO para mtCcO o 100% de CO para bo3 UqO. Para investigar la unión de CO a la enzima reducida, se mezclaron un volumen igual de la solución de enzima reducida y la solución de CO en un espectrómetro de flujo detenido a 4 °C.

Se utilizó un analizador de flujo extracelular XFe96 (Agilent) para medir la tasa de consumo de oxígeno (OCR). Se sembraron células C2C12 de ratón en una microplaca de cultivo XFe96 (1,0 x 104 células por pocillo) un día antes de la medición. La OCR de cada pocillo se midió en DMEM sin tampón que contenía l-glutamina 2 mM y piruvato de sodio 1 mM en condiciones basales y en respuesta a oligomicina A 1 µM (Oligo A), fenilhidrazona de cianuro de fluorocarbonilo 2 µM (FCCP) y 0,5 µM. rotenona + antimicina A 0,5 µM (Anti/Rote). El OCR para la producción de ATP se calculó como OCR basal-Oligo A OCR utilizando Mito Stress Test Report Generator.

Se utilizó un ensayo de LDH en microplaca (kit de ensayo de citotoxicidad LDH, Dojindo, CK12) para determinar la citotoxicidad de Q275. Las células de mamífero utilizadas fueron cardiomiocitos neonatales de rata, cultivados en DMEM suplementado con suero fetal bovino al 10%. Las células se sembraron en una placa tratada con cultivo de tejidos, de fondo plano, de 96 pocillos y se incubaron a 37 °C con 5% de CO2. Después de 24 horas, se aspiró el medio y se reemplazó con medio nuevo que contenía los compuestos de prueba. Después de 24 h de incubación, se evaluó la actividad de LDH en el sobrenadante según las instrucciones del fabricante.

Para adquirir la secuencia de aminoácidos de la base de datos, se seleccionó preferentemente la secuencia cuya estructura cristalina fue dilucidada y registrada en el PDB (se mostró el PDB ID). Para otras secuencias de aminoácidos, se seleccionaron las representativas del taxón de los tipos de enzimas HCO A, B, C y NOR según el informe anterior41. Estos indicaron lo siguiente: Bos taurus (5B1A_1), Homo sapiens (5Z62_1), Saccharomyces cerevisiae (6T15_11), Pseudomonas stutzeri (3MK7_1), Rhodobacter capsulatus (6XKX_4), Thermus thermophilus (A2:2YEV_1, ba3:1EHK_1), Escherichia coli ( 1FFT_1), Bacillus subtilis (bo3: 6KOB_1, aa3: P24010), Mus musculus (BBA31677), Aquifex (A1: O67935, A2: O67937), Rhodothermus marinus (CAC08532), Paracoccus denitrificans (P08305), Yersinia pestis (WP0425935) 20), Pseudomonas aeruginosa (MXH36788), Snodgrassella alvi (WP_100091491), bacteria Rickettsiales (MBB19300), Lacrimispora indolis (VDG67555), Halobacterium (WP_010902450), Natronomonas pharaonis (CAA71525), Geobacillus stearothermophilus (3AY G), y Pseudomonas aeruginosa (3O0R).

La alineación de secuencias de múltiples aminoácidos se realizó utilizando Clustal Omega v1.2.1 después de recortar el extremo N para alinear la longitud total de la alineación79. Se utilizó un parámetro predeterminado y se confirmó visualmente la conservación de regiones esenciales para la vía de los protones (canal de protones) en los HCO, como los ligandos metálicos y los residuos catalíticos de tirosina. Los árboles de unión de vecinos (NJ) se infirieron con el algoritmo BioNJ80 utilizando PhyML v2016011581 con los siguientes parámetros: 1000 bootstraps, 100 semillas y corrección para múltiples sustituciones. Se creó y visualizó un árbol de consenso mayoritario en Dendroscope v3.7582.

No se aplicaron estadísticas excepto el análisis de DE para la Fig. 5f, g. Los experimentos se repitieron al menos dos veces y confirmaron su reproducibilidad.

Más información sobre el diseño de la investigación está disponible en el Resumen del informe de Nature Portfolio vinculado a este artículo.

Los datos que respaldan este estudio están disponibles a través de los autores correspondientes previa solicitud razonable. Los mapas crio-EM se han depositado en el Banco de datos de microscopía electrónica EMDB con el código de acceso EMD-33293 (apo-bo3 UqO) y EMD-33294 (holo-bo3 UqO). Las coordenadas han estado en el Protein Data Bank (PDB) con el código de acceso 7XMA (apo-mtCcO), 7XMB (holo-mtCcO), 7XMC (apo-bo3 UqO), 7XMD (holo-bo3 UqO). Los códigos de acceso publicados anteriormente utilizados en este trabajo son 5B1A y se utilizaron para el cálculo de la fase inicial en el experimento de difracción de rayos X. Se utilizó 3AG2 para la simulación MD. Para la Fig. 7 complementaria, 5Z62, 5B1A, 6GIQ, 6KOB, 6WTI, 1QLE, 2YEV, 1EHK, 6XKW, 5DJQ, 3AYG, 3O0R. Los datos de origen subyacentes a las Figs. 2B–E, 3E, 4B–I, 5B, D, F, G, S1A–C, S4A–D, S5D, H, J, S6A–D se proporcionan como un archivo de datos de origen. Los datos fuente se proporcionan en este documento.

Se ha publicado una corrección a este artículo: https://doi.org/10.1038/s41467-022-35600-y

Laxminarayan, R. et al. Resistencia a los antibióticos: la necesidad de soluciones globales. Infección por lanceta. Dis. 13, 1057–1098 (2013).

Artículo de Google Scholar

Unemo, M. et al. Vigilancia mundial de la resistencia a los antimicrobianos de la OMS para Neisseria gonorrhoeae 2017-18: un estudio observacional retrospectivo. Lancet Microbe 5247, 3–5 (2021).

Google Académico

Centros de Control y Prevención de Enfermedades. Amenazas de resistencia a los antibióticos en los Estados Unidos. Centros Dis. Controlar anterior. 1–113 https://doi.org/10.15620/cdc:82532 (2019).

Unemo, M. et al. Programa Mundial de Vigilancia Antimicrobiana Gonocócica de la Organización Mundial de la Salud (OMS GASP): revisión de nuevos datos y evidencia para informar acciones de colaboración internacional y esfuerzos de investigación. Sexo. Salud 16, 412 (2019).

Artículo de Google Scholar

Bald, D., Villellas, C., Lu, P. y Koul, A. Dirigirse al metabolismo energético en Mycobacterium tuberculosis, un nuevo paradigma en el descubrimiento de fármacos antimicobacterianos. MBio 8, e00272—17-11 (2017).

Artículo de Google Scholar

Cook, GM, Hards, K., Vilchèze, C., Hartman, T. & Berney, M. Energética de la respiración y fosforilación oxidativa en micobacterias. Microbiol. Espectro. 2, 1-20 (2014).

Artículo CAS Google Scholar

Goodman, CD y cols. Los parásitos resistentes al antipalúdico atovacuona no se transmiten por mosquitos. Ciencia (80-.) 352, 349–353 (2016).

Artículo ADS CAS Google Scholar

Hasenoehrl, EJ, Wiggins, TJ y Berney, M. Inhibidores bioenergéticos: eficacia antibiótica y mecanismos de acción en Mycobacterium tuberculosis. Frente. Celúla. Infectar. Microbiol. 10, 1–26 (2021).

Artículo de Google Scholar

Duvenage, L., Munro, CA y Gourlay, CW El potencial de la inhibición de la respiración como un nuevo enfoque para combatir los hongos patógenos humanos. actual. Gineta. 65, 1347-1353 (2019).

Artículo CAS Google Scholar

Shiba, T. y col. Estructura de la oxidasa alternativa insensible al cianuro del tripanosoma. Proc. Acad. Nacional. Ciencia. Estados Unidos 110, 4580–4585 (2013).

Artículo ADS CAS Google Scholar

Luo, M. y col. La bedaquilina inhibe las ATP sintasas mitocondriales humanas y de levaduras. Comunitario. Biol. 3, 1-10 (2020).

Artículo de Google Scholar

Wenthur, CJ, Gentry, PR, Mathews, TP y Lindsley, CW Medicamentos para sitios alostéricos en los receptores. Año. Rev. Farmacol. Toxico. 54, 165–184 (2014).

Artículo CAS Google Scholar

Nussinov, R. & Tsai, CJ Allostery en enfermedades y descubrimiento de fármacos. Celda 153, 293–305 (2013).

Artículo CAS Google Scholar

Tsukihara, T. y col. Toda la estructura de la citocromo c oxidasa oxidada de 13 subunidades a 2,8 Å. Ciencia (80-.) 272, 1136–1144 (1996).

Artículo ADS CAS Google Scholar

Iwata, S., Ostermeier, C., Ludwig, B., Hartmut, B. y Michel, H. Estructura con una resolución de 2,8 Å de la citocromo c oxidasa de Paracoccus denitrificans. Naturaleza 376, 660–669 (1995).

Artículo ADS CAS Google Scholar

Yoshikawa, S. y Shimada, A. Mecanismo de reacción de la citocromo c oxidasa. Química. Rev. 115, 1936–1989 (2015).

Artículo CAS Google Scholar

Rich, PR Citocromo c oxidasa mitocondrial: catálisis, acoplamiento y controversias. Bioquímica. Soc. Trans. 45, 813–829 (2017).

Artículo CAS Google Scholar

Ishigami, I., Hikita, M., Egawa, T., Yeh, SR y Rousseau, DL Translocación de protones en la citocromo c oxidasa: conocimientos de la cinética del intercambio de protones y la espectroscopia vibratoria. Biochim. Biofísica. Acta—Bioenergía. 1847, 98-108 (2015).

Artículo CAS Google Scholar

Wikström, M., Krab, K. & Sharma, V. Activación de oxígeno y conservación de energía por la citocromo c oxidasa. Química. Rev. 118, 2469–2490 (2018).

Artículo de Google Scholar

Sagan, L. Sobre el origen de las células mitosantes. J. Theor. Biol. 14, 225–IN6 (1967).

Artículo ADS CAS Google Scholar

Wallace, DC ¿Por qué todavía tenemos un ADN mitocondrial heredado de la madre? Perspectivas de la medicina evolutiva. Año. Rev. Bioquímica. 76, 781–821 (2007).

Artículo CAS Google Scholar

Werner, F. & Grohmann, D. Evolución de ARN polimerasas multisubunitarias en los tres dominios de la vida. Nat. Rev. Microbiol. 9, 85–98 (2011).

Artículo CAS Google Scholar

Petrov, AS et al. Historia del ribosoma y el origen de la traducción. Proc. Acad. Nacional. Ciencia. Estados Unidos 112, 15396–15401 (2015).

Artículo ADS CAS Google Scholar

Hayashi, T. y col. Higd1a es un regulador positivo de la citocromo c oxidasa. Proc. Acad. Nacional. Ciencia. Estados Unidos 112, 1553-1558 (2015).

Artículo ADS CAS Google Scholar

Nagao, T. y col. Higd1a mejora la función respiratoria en los modelos de trastorno mitocondrial. FASEB J. 34, 1859–1871 (2020).

Artículo CAS Google Scholar

Okada-Iwabu, M. et al. Un agonista de AdipoR de molécula pequeña para la diabetes tipo 2 y una vida corta en la obesidad. Naturaleza 503, 493–499 (2013).

Artículo ADS CAS Google Scholar

Sato, T. y col. Aplicación de una máquina de vectores de soporte a la detección virtual basada en formas tridimensionales utilizando una superposición integral de formas moleculares tridimensionales con inhibidores conocidos. J. química. inf. Modelo. 52, 1015-1026 (2012).

Artículo CAS Google Scholar

Borisov, VB, Gennis, RB, Hemp, J. y Verkhovsky, MI Las reductasas de oxígeno respiratorio del citocromo bd. Biochim. Biofísica. Acta—Bioenergía. 1807, 1398-1413 (2011).

Artículo CAS Google Scholar

Unemo, M. & Shafer, WM Resistencia a los antimicrobianos en Neisseria gonorrhoeae en el siglo XXI: pasado, evolución y futuro. Clínico. Microbiol. Rev. 27, 587–613 (2014).

Artículo de Google Scholar

Knapp, JS & Clark, VL Crecimiento anaeróbico de Neisseria gonorrhoeae junto con la reducción de nitritos. Infectar. Inmune. 46, 176–181 (1984).

Artículo CAS Google Scholar

Falsetta, ML y cols. El perfil transcripcional identifica el fenotipo metabólico de las biopelículas gonocócicas. Infectar. Inmune. 77, 3522–3532 (2009).

Artículo CAS Google Scholar

Stevanin, TMTM, Moir, JWBB & Read, RC Los sistemas de desintoxicación de óxido nítrico mejoran la supervivencia de Neisseria meningitidis en macrófagos humanos y en la mucosa nasofaríngea. Infectar. Inmune. 73, 3322–3329 (2005).

Artículo CAS Google Scholar

Matsumoto, Y. et al. Estructura cristalina de la óxido nítrico reductasa dependiente de quinol de Geobacillus stearothermophilus. Nat. Estructura. Mol. Biol. 19, 238–245 (2012).

Artículo CAS Google Scholar

Gonska, N. y col. Caracterización de la óxido nítrico reductasa dependiente de quinol del patógeno Neisseria meningitidis, una enzima electrogénica. Ciencia. Representante 8, 1-13 (2018).

Artículo ADS CAS Google Scholar

Yano, N. y col. El grupo de agua que contiene Mg2+ de la citocromo c oxidasa de mamíferos recolecta cuatro equivalentes de protones de bombeo en cada ciclo catalítico. J. Biol. Química. 291, 23882–23894 (2016).

Artículo CAS Google Scholar

Motlagh, HN, Wrabl, JO, Li, J. & Hilser, VJ La naturaleza conjunta del alosterio. Naturaleza 508, 331–339 (2014).

Artículo ADS CAS Google Scholar

Ogura, T., Yoshikawa, S. & Kitagawa, T. Estudio de resonancia Raman sobre la fotorreducción de la citocromo c oxidasa: distinción de los citocromos a y a3 en los estados de oxidación intermedios. Bioquímica 24, 7746–7752 (1985).

Artículo CAS Google Scholar

Kitagawa, T. & Orii, Y. Estudios de resonancia Raman de la citocromo oxidasa. J. Bioquímica. 84, 1245-1252 (1978).

Artículo CAS Google Scholar

Salomonsson, L., Lee, A., Gennis, RB y Brzezinski, P. Una tapa de un solo aminoácido crea un compartimento hermético a los gases dentro de un transportador unido a una membrana. Proc. Acad. Nacional. Ciencia. Estados Unidos 101, 11617–11621 (2004).

Artículo ADS CAS Google Scholar

Unemo, M. et al. Gonorrea. Nat. Rev. Dis. Prisma. 5, 79 (2019).

Sousa, FL et al. La superfamilia de oxígeno reductasas hemo-cobre: ​​tipos y consideraciones evolutivas. Biochim. Biofísica. Acta—Bioenergía. 1817, 629–637 (2012).

Artículo CAS Google Scholar

Bax, R. & Green, S. Antibióticos: el paradigma cambiante de la industria farmacéutica y regulatoria. J. Antimicrobios. Chemadre. 70, 1281-1284 (2014).

Artículo de Google Scholar

Kakishima, K., Shiratsuchi, A., Taoka, A., Nakanishi, Y. y Fukumori, Y. Participación de la óxido nítrico reductasa en la supervivencia de Pseudomonas aeruginosa en macrófagos activados por LPS. Bioquímica. Biofísica. Res. Comunitario. 355, 587–591 (2007).

Artículo CAS Google Scholar

Rhee, KY y Gardiner, DF Relevancia clínica de la actividad bacteriostática versus bactericida en el tratamiento de infecciones bacterianas grampositivas [2]. Clínico. Infectar. Dis. 39, 755–756 (2004).

Artículo de Google Scholar

Li, J. y col. Las estructuras crio-EM del citocromo bo 3 de Escherichia coli revelan fosfolípidos unidos y ubiquinona-8 en un sitio de unión de sustrato dinámico. Proc. Acad. Nacional. Ciencia. Estados Unidos 118, e2106750118 (2021).

Artículo CAS Google Scholar

Reidelbach, M., Zimmer, C., Meunier, B., Rich, PR y Sharma, V. Transferencia de electrones acoplada a la dinámica conformacional en la respiración celular. Frente. Mol. Biosci. 8, 1-12 (2021).

Artículo de Google Scholar

Tunyasuvunakool, K. et al. Predicción de estructura proteica de alta precisión para el proteoma humano. Naturaleza https://doi.org/10.1038/s41586-021-03828-1 (2021).

Artículo de Google Scholar

Baek, M. y col. Predicción precisa de estructuras e interacciones de proteínas utilizando una red neuronal de tres vías. Ciencia (80-.) 8754, eabj8754 (2021).

Google Académico

Shinzawa-Itoh, K. et al. La estructura de resolución de 1,3 Å de la citocromo c oxidasa bovina sugiere un mecanismo de dimerización. BBA Avanzado. 1, 100009 (2021).

Artículo CAS Google Scholar

Kabsch, W. XDS. Acta Crystallogr. Secta. D Biol. Cristalogr. 66, 125-132 (2010).

Artículo CAS Google Scholar

Vagin, A. & Teplyakov, A. MOLREP: un programa automatizado para reemplazo molecular. J. Aplica. Cristalogr. 30, 1022-1025 (1997).

Artículo CAS Google Scholar

Adams, PD y cols. PHENIX: un sistema integral basado en Python para la solución de estructuras macromoleculares. Acta Crystallogr. Secta. D Biol. Cristalogr. 66, 213–221 (2010).

Artículo CAS Google Scholar

Brunger, AT Versión 1.2 del sistema de cristalografía y RMN. Nat. Protocolo. 2, 2728–2733 (2007).

Artículo CAS Google Scholar

Emsley, P. y Cowtan, K. Coot: herramientas de construcción de modelos para gráficos moleculares. Acta Crystallogr. Secta. D Biol. Cristalogr. 60, 2126-2132 (2004).

Artículo de Google Scholar

Murshudov, GN et al. REFMAC5 para el refinamiento de estructuras cristalinas macromoleculares. Acta Crystallogr. Secta. D Biol. Cristalogr. 67, 355–367 (2011).

Artículo CAS Google Scholar

Afonine, PV et al. Hacia el refinamiento automatizado de la estructura cristalográfica con phenix.refine. Acta Crystallogr. Secta. D Biol. Cristalogr. 68, 352–367 (2012).

Artículo CAS Google Scholar

Maier, JA et al. ff14SB: mejora de la precisión de los parámetros de la cadena lateral y la columna vertebral de las proteínas de ff99SB. J. química. Computación teórica. 11, 3696–3713 (2015).

Artículo CAS Google Scholar

Dickson, CJ y cols. Lipid14: el campo de fuerza de los lípidos de color ámbar. J. química. Computación teórica. 10, 865–879 (2014).

Artículo CAS Google Scholar

Jo, S., Kim, T., Iyer, VG & Im, W. CHARMM-GUI: una interfaz gráfica de usuario basada en web para CHARMM. J. Computación. Química. 29, 1859–1865 (2008).

Artículo CAS Google Scholar

Sato, W. y col. Mecanismo energético de la formación del complejo de transferencia de electrones citocromo c-citocromo c oxidasa en condiciones de recambio revelado por efectos mutacionales y simulación de acoplamiento. J. Biol. Química. 291, 15320–15331 (2016).

Artículo CAS Google Scholar

Ewald, PP El cálculo de potenciales de red ópticos y electrostáticos. Ana. Física. 369, 253-287 (1921).

Artículo MATEMÁTICAS Google Scholar

Abraham, MJ y cols. Gromacs: simulaciones moleculares de alto rendimiento mediante paralelismo multinivel desde portátiles hasta supercomputadoras. SoftwareX 1–2, 19–25 (2015).

ADS del artículo Google Scholar

Bussi, G., Donadio, D. y Parrinello, M. Muestreo canónico mediante reescalado de velocidad. J. química. Física. 126, (2007).

Berendsen, HJC, Postma, JPM, van Gunsteren, WF, DiNola, A. & Haak, JR Dinámica molecular con acoplamiento a un baño externo. J. química. Física. 81, 3684–3690 (1984).

Artículo ADS CAS Google Scholar

Morita, R., Nakano, K., Shigeta, Y. y Harada, R. Mecanismo molecular para el dominio de unión a actina de la α-actinina Ain1 dilucidado mediante simulaciones de dinámica molecular y experimentos de mutagénesis. J. Física. Química. B 124, 8495–8503 (2020).

Artículo CAS Google Scholar

Lai, LY, Samoilova, RI, Gennis, RB & Dikanov, SA Caracterización de los protones intercambiables en las inmediaciones del radical semiquinona en el sitio QH del citocromo bo 3 de Escherichia coli. J. Biol. Química. 281, 16879–16887 (2006).

Artículo de Google Scholar

Abramson, J. y col. Purificación, cristalización y estudios cristalográficos preliminares de una proteína integral de membrana, el citocromo bo 3 ubiquinol oxidasa de Escherichia coli. Acta Crystallogr. Secta. D Biol. Cristalogr. 56, 1076-1078 (2000).

Artículo CAS Google Scholar

Köhler, G. & Milstein, C. Cultivos continuos de células fusionadas que secretan anticuerpos de especificidad predefinida. Nature 256, 495–497 (1975).

ADS del artículo Google Scholar

Tanabe, H. y col. Expresión, purificación, cristalización y estudios cristalográficos preliminares de rayos X de los receptores de adiponectina humanos, AdipoR1 y AdipoR2. J. Estructura. Función. Genoma. 16, 11-23 (2015).

Artículo CAS Google Scholar

Mastronarde, DN SerialEM: un programa para la adquisición automatizada de series de inclinación en microscopios Tecnai mediante la predicción de la posición de la muestra. Microscopía. Microanal. 9, 1182-1183 (2003).

ADS del artículo Google Scholar

Zivanov, J. y col. Nuevas herramientas para la determinación automatizada de estructuras crio-EM de alta resolución en RELION-3. Elife 7, 1-22 (2018).

Artículo de Google Scholar

Zheng, SQ y cols. MotionCor2: corrección anisotrópica del movimiento inducido por el haz para mejorar la microscopía crioelectrónica. Nat. Métodos 14, 331–332 (2017).

Artículo CAS Google Scholar

Rohou, A. & Grigorieff, N. CTFFIND4: estimación de desenfoque rápida y precisa a partir de micrografías electrónicas. J. Estructura. Biol. 192, 216–221 (2015).

Artículo de Google Scholar

Pettersen, EF y cols. UCSF Chimera: un sistema de visualización para investigación y análisis exploratorios. J. Computación. Química. 25, 1605-1612 (2004).

Artículo CAS Google Scholar

Unemo, M. et al. Las nuevas cepas de referencia de Neisseria gonorrhoeae de la OMS de 2016 para el aseguramiento de la calidad global de las investigaciones de laboratorio: caracterización fenotípica, genética y del genoma de referencia. J. Antimicrobios. Chemadre. 71, 3096–3108 (2016).

Artículo CAS Google Scholar

Nakayama, SI et al. Nueva cepa de Neisseria gonorrhoeae resistente a ceftriaxona y a múltiples fármacos con un nuevo gen mosaico penA aislado en Japón. Antimicrobiano. Agentes Chemother. 60, 4339–4341 (2016).

Artículo CAS Google Scholar

Wade, JJ & Graver, MA Un medio líquido completamente definido, transparente y libre de proteínas que permite un crecimiento denso de Neisseria gonorrhoeae a partir de inóculos muy bajos. Microbiol FEMS. Letón. 273, 35–37 (2007).

Artículo CAS Google Scholar

Takahashi, H. & Watanabe, H. Un homólogo gonocócico del gen meningocócico de la γ-glutamil transpeptidasa es un nuevo tipo de pseudogén bacteriano que es transcripcionalmente activo pero fenotípicamente silencioso. BMC Microbiol. 5, 1-13 (2005).

Artículo de Google Scholar

Sievers, F. & Higgins, DG El paquete de alineación múltiple omega clustal. Métodos Mol. Biol. 2231, 3–16 (2021).

Artículo CAS Google Scholar

Gascuel, O. BIONJ: una versión mejorada del algoritmo NJ basada en un modelo simple de datos de secuencia. Mol. Biol. Evolución. 14, 685–695 (1997).

Artículo CAS Google Scholar

Guindon, S. y col. Nuevos algoritmos y métodos para estimar filogenias de máxima verosimilitud: evaluación del rendimiento de PhyML 3.0. Sistema. Biol. 59, 307–321 (2010).

Artículo CAS Google Scholar

Huson, DH y cols. Dendroscopio: un visor interactivo de grandes árboles filogenéticos. Bioinformación de BMC. 8, 1–6 (2007).

Artículo de Google Scholar

Descargar referencias

En primer lugar, todos los autores agradecen enormemente al Dr. Tomitake Tsukihara y al Dr. Shinya Yoshikawa por sus esclarecedores consejos y debates sobre el proyecto. Agradecemos enormemente a la Sra. Akiko Ogai por la ayuda con la preparación de proteínas; a la Sra. Satomi Kobayashi, la Sra. Kanami Inagaki, la Sra. Keiko Shingu y la Sra. Satomi Gion por su asistencia de laboratorio; la Sra. Yuko Okada, la Sra. Hisae Kawasaki y la Sra. Yukako Kurokawa por su asistencia como secretarias; Dr. Yuki Nakamura por la ayuda en la adquisición de datos en SPring-8 BL26; al Dr. Hiroshi Aoyama por su ayuda en la preparación de cristales para el experimento de rayos X; Dr. Takeshi Yokoyama, Dr. Tomomi Uchikubo, Dr. Mikako Shirouzu por su orientación sobre el análisis crio-EM de partículas individuales; Dr. Naruhiko Adachi y Dr. Masato Kawasaki por la evaluación inicial para la adquisición de datos crio-EM de la preparación de bo3 oxidasa de E. coli (según BINDS 1721); Dr. Robert Gennis y Dr. Sangjin Hong por proporcionar cepas de E. coli y construcción de bo3 oxidasa de E. coli; al Dr. Yoshio Nakatani por proporcionar cepas de E. coli; al Dr. Ken Daniel Inaoka y al Dr. Kiyoshi Kita por proporcionar cepas de E. coli y consejos sobre la preparación de la proteína bo3; Dr. Vivek Sharma por su ayuda en la preparación para la simulación de MD; Dr. Hiroshi Sugimoto por sus consejos sobre el análisis estructural de bo3; Dr. Naoki Mochizuki, Dr. Kazu Kikuchi y Dr. Hajime Fukui por sus comentarios sobre el manuscrito, Dr. James Pearson por la edición en inglés; Sra. C. Shintani por sus consejos sobre la preparación de la figura. Esta investigación fue apoyada por el Proyecto de plataforma para apoyar el descubrimiento de fármacos y la investigación en ciencias biológicas (Base para apoyar el descubrimiento de fármacos innovadores y la investigación en ciencias biológicas (BINDS)) de la Agencia Japonesa para la Investigación y el Desarrollo Médico (AMED) con los números de subvención, JP19am0101113, JP21am0101070, JP20am0101071. , JP21am0101082, JP20am0101109, JP20am0101083 (números de soporte 1096, 1099, 1721, 2161, 2310 y 2357). Los experimentos de radiación sincrotrón se realizaron en SPring-8 con la aprobación del Instituto de Investigación de Radiación Sincrotrón de Japón (JASRI) (Propuesta No. 2016A2529, 2016B2711, 2017A2555 y 2017B2721, 2018A2721, 2021B2523, 2022A2713). Este trabajo fue apoyado por fondos de la Agencia de Ciencia y Tecnología de Japón-Investigación central para ciencia y tecnología evolutivas (CREST) ​​con el número de subvención, JPMJCR14M2 para ST AMED con el número de subvención, JP19im0210617, JP21ek0109499 y JP22fk0108632 para YShintani. JP21fk0108605 a MO Subvenciones para investigación científica de la Sociedad Japonesa para la Promoción de la Ciencia con números de subvención, 21H02914 a ST, 21K15443 a YN, 19H05784 a MK y 20K03794 a KK Subvenciones para investigación innovadora “Biometal Ciencias” bajo la subvención número 20H05497 a Y.Shigeta.

Hideki Shigematsu

Dirección actual: División de Biología Estructural, Instituto de Investigación de Radiación Sincrotrón de Japón, SPring-8; Sayo, Hyogo, Japón

Estos autores contribuyeron igualmente: Sachiko Yanagisawa, Rikuri Morita.

Departamento de Farmacología Molecular, Centro Nacional Cerebral y Cardiovascular, Suita, Osaka, Japón

Yuya Nishida, Chisa Nakabayashi, Takemasa Nagao, Tasneem Qaqorh, Yusuke Takahashi, Satoru Yamazaki y Yasunori Shintani

Departamento de Bioquímica Médica, Escuela de Graduados en Ciencias Biológicas Fronterizas de la Universidad de Osaka, Suita, Osaka, Japón

Yuya Nishida, Takashi Iwamoto, Chisa Nakabayashi, Hisakazu Kato, Tasneem Qaqorh, Seiji Takashima y Yasunori Shintani

Escuela de Graduados en Ciencias, Universidad de Hyogo, Hyogo, Japón

Sachiko Yanagisawa, Kyoko Shinzawa-Itoh, Waka Matsumura, Kazumasa Muramoto, Yoshitsugu Shiro y Minoru Kubo

Centro de Ciencias Computacionales, Universidad de Tsukuba, Tsukuba, Ibaraki, Japón

Rikuri Morita, Ryuhei Harada y Yasuteru Shigeta

RIKEN SPring-8 Center, 1-1-1 Kouto, Sayo, Hyogo, Japón

Hideki Shigematsu, Chai Gopalasingam y Takehiko Tosha

Centro RIKEN para la Investigación de la Dinámica de Biosistemas, Yokohama, Kanagawa, Japón

Hitomi Yuki y Teruki Honma

Departamento de Química, Escuela de Graduados en Ciencias, Universidad de Chiba, Inage, Chiba, Japón

Satoshi Ogasawara y Takeshi Murata

Departamento de Bacteriología I, Instituto Nacional de Enfermedades Infecciosas, Tokio, Japón

Ken Shimuta, Hideyuki Takahashi, Yukihiro Akeda y Makoto Ohnishi

Centro de Investigación de Resistencia a los Antimicrobianos, Instituto Nacional de Enfermedades Infecciosas, Tokio, Japón

Ken Shimuta

Centro de Aprendizaje Integrado de Educación Básica, Instituto de Tecnología de Kanagawa, Atsugi, Kanagawa, Japón

Katsumasa Kamiya

División de Análisis de Cristales de Proteínas, Instituto de Investigación de Radiación Sincrotrón de Japón, SPring-8, Sayo, Hyogo, Japón

Nobuhiro Mizuno y Takashi Kumasaka

Departamento de Microbiología y Enfermedades Infecciosas, Facultad de Medicina de la Universidad de Toho, Tokio, Japón

Yoshikazu Ishii

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

También puedes buscar este autor en PubMed Google Scholar.

Y. Shintani concibió el proyecto y realizó la detección del inhibidor de mtCcO. Y.Shintani y YN diseñaron la estrategia experimental y analizaron los datos. YN realizó cristalografía de rayos X, análisis crio-EM de partículas individuales, detección de compuestos in silico y la mayoría de experimentos bioquímicos. S.Yanagisawa realizó experimentos espectroscópicos de resonancia Raman y analizó los datos con WM y MKRM realizó una simulación MD y analizó los datos con KK, RH, HY, YN e Y.Shigeta. HS realizó la adquisición de datos crio-EM y ayudó en el análisis de datos. NM y TK contribuyeron a la recopilación de datos de cristales y ayudaron al análisis estructural de rayos X. KSI proporcionó cristales de mtCcO y mtCcO bovinos purificados durante todo el proyecto. YN realizó la detección de compuestos in silico con HY bajo la supervisión de THSO y TM generó los anticuerpos monoclonales para el análisis crio-EM de bo3 oxidasa. KS, HT, YA y MO proporcionaron las cepas de N. gonorrhoeae y realizaron la determinación de la CIM. YI analizó y brindó asesoramiento sobre los experimentos con N. gonorrhoeae. TI realizó un experimento bioquímico con bo3. CN realizó el experimento bioquímico Neisseria meningitidis bb3 qNOR. HK realizó mediciones de OCR utilizando XFe96 Fluxanalyser. S.Yamazaki, TN, TQ e YT realizaron análisis de datos que incluyeron análisis filogénico y preparación de figuras. CG, KM, TT e Y.Shiro proporcionaron la enzima qNOR bb3, la construcción de expresión y el entorno experimental para qNOR. Y. Shintani, YN preparó el manuscrito original. ST ayudó con la revisión del manuscrito original y obtuvo financiación. Todos los autores revisaron y editaron el manuscrito.

Correspondencia a Yasunori Shintani.

Los autores declaran no tener conflictos de intereses.

Nature Communications agradece a los revisores anónimos por su contribución a la revisión por pares de este trabajo. Los informes de los revisores pares están disponibles.

Nota del editor Springer Nature se mantiene neutral con respecto a reclamos jurisdiccionales en mapas publicados y afiliaciones institucionales.

Acceso Abierto Este artículo está bajo una Licencia Internacional Creative Commons Attribution 4.0, que permite el uso, compartir, adaptación, distribución y reproducción en cualquier medio o formato, siempre y cuando se dé el crédito apropiado a los autores originales y a la fuente. proporcione un enlace a la licencia Creative Commons e indique si se realizaron cambios. Las imágenes u otro material de terceros en este artículo están incluidos en la licencia Creative Commons del artículo, a menos que se indique lo contrario en una línea de crédito al material. Si el material no está incluido en la licencia Creative Commons del artículo y su uso previsto no está permitido por la normativa legal o excede el uso permitido, deberá obtener permiso directamente del titular de los derechos de autor. Para ver una copia de esta licencia, visite http://creativecommons.org/licenses/by/4.0/.

Reimpresiones y permisos

Nishida, Y., Yanagisawa, S., Morita, R. et al. Identificación de antibióticos basándose en diferencias estructurales en el alosterio conservado de las oxidasas hemo-cobre mitocondriales. Nat Comuna 13, 7591 (2022). https://doi.org/10.1038/s41467-022-34771-y

Descargar cita

Recibido: 15 de mayo de 2022

Aceptado: 07 de noviembre de 2022

Publicado: 08 de diciembre de 2022

DOI: https://doi.org/10.1038/s41467-022-34771-y

Cualquier persona con la que comparta el siguiente enlace podrá leer este contenido:

Lo sentimos, actualmente no hay un enlace para compartir disponible para este artículo.

Proporcionado por la iniciativa de intercambio de contenidos Springer Nature SharedIt

Al enviar un comentario, acepta cumplir con nuestros Términos y pautas de la comunidad. Si encuentra algo abusivo o que no cumple con nuestros términos o pautas, márquelo como inapropiado.